ID: 1059023274_1059023288

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1059023274 1059023288
Species Human (GRCh38) Human (GRCh38)
Location 9:110598844-110598866 9:110598889-110598911
Sequence CCCCCCAGGCACTCCATCCCAGG CTTAGAACATGAGCGGGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 30, 3: 100, 4: 570} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!