ID: 1059023274_1059023289

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1059023274 1059023289
Species Human (GRCh38) Human (GRCh38)
Location 9:110598844-110598866 9:110598890-110598912
Sequence CCCCCCAGGCACTCCATCCCAGG TTAGAACATGAGCGGGGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 30, 3: 100, 4: 570} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!