ID: 1059107135_1059107144

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1059107135 1059107144
Species Human (GRCh38) Human (GRCh38)
Location 9:111521584-111521606 9:111521610-111521632
Sequence CCCCTCCCTGCGCTGGGTCTCAT TGAAAAAATAGGATATGGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!