ID: 1059596005_1059596009

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1059596005 1059596009
Species Human (GRCh38) Human (GRCh38)
Location 9:115721331-115721353 9:115721358-115721380
Sequence CCTTTCTGCTAGGTAATGTATTA GGTAATGTATTCACGGGTATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!