ID: 1059615310_1059615315

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1059615310 1059615315
Species Human (GRCh38) Human (GRCh38)
Location 9:115944452-115944474 9:115944488-115944510
Sequence CCTCTGATTTACCCAGTGTCCAG TCTTGAAATTTCTAAGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!