ID: 1060514635_1060514656

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1060514635 1060514656
Species Human (GRCh38) Human (GRCh38)
Location 9:124258121-124258143 9:124258165-124258187
Sequence CCCCGCGGCCCGGAGAAGGGCGG ACCCCCAGCCGGGCCGAGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129} {0: 1, 1: 0, 2: 2, 3: 18, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!