ID: 1060514645_1060514656

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1060514645 1060514656
Species Human (GRCh38) Human (GRCh38)
Location 9:124258130-124258152 9:124258165-124258187
Sequence CCGGAGAAGGGCGGGGGCCGGGC ACCCCCAGCCGGGCCGAGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 420} {0: 1, 1: 0, 2: 2, 3: 18, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!