ID: 1060643859_1060643867

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1060643859 1060643867
Species Human (GRCh38) Human (GRCh38)
Location 9:125261773-125261795 9:125261808-125261830
Sequence CCCCCGCGGCGCTGCGCACGCGC GCAGCGCCGCTGCAGGACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 152} {0: 1, 1: 0, 2: 2, 3: 13, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!