ID: 1060723684_1060723700

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1060723684 1060723700
Species Human (GRCh38) Human (GRCh38)
Location 9:125994198-125994220 9:125994248-125994270
Sequence CCTGGCCTCCATCCTGCTCTTAG GAGGAGGGAACAGGCCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 399} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!