ID: 1060758945_1060758947

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1060758945 1060758947
Species Human (GRCh38) Human (GRCh38)
Location 9:126232828-126232850 9:126232847-126232869
Sequence CCAAGTTCAGGGCAAGGGACCAC CCACTGTCTCCACTATCCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 35, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!