ID: 1060832065_1060832078

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1060832065 1060832078
Species Human (GRCh38) Human (GRCh38)
Location 9:126723054-126723076 9:126723093-126723115
Sequence CCTTTCCAGCGCTGCCCCAGGCA CAGCCAACGGCCCCAGTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 341} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!