ID: 1061183234_1061183247

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1061183234 1061183247
Species Human (GRCh38) Human (GRCh38)
Location 9:129037142-129037164 9:129037181-129037203
Sequence CCCGGCATGGTGGGACTATTGAG GAATAGGAGACTGGGCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 112} {0: 2, 1: 0, 2: 5, 3: 70, 4: 736}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!