ID: 1061195346_1061195362

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1061195346 1061195362
Species Human (GRCh38) Human (GRCh38)
Location 9:129104151-129104173 9:129104202-129104224
Sequence CCGGCTGCCTCCTGGCCCCCAAA CAGGTCCACGAAGTCCTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 550} {0: 1, 1: 0, 2: 1, 3: 7, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!