ID: 1061282982_1061282986

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1061282982 1061282986
Species Human (GRCh38) Human (GRCh38)
Location 9:129608043-129608065 9:129608065-129608087
Sequence CCTCCGGGTTGCACACTGCTGGC CCTCTTGCGGTATCCGCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 108} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!