ID: 1061436767_1061436771

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1061436767 1061436771
Species Human (GRCh38) Human (GRCh38)
Location 9:130568190-130568212 9:130568216-130568238
Sequence CCTGGTAGTCAAGAGAATGAGAG TAATTTAAGATAGTGGGGTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!