ID: 1061584040_1061584051

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1061584040 1061584051
Species Human (GRCh38) Human (GRCh38)
Location 9:131554954-131554976 9:131554987-131555009
Sequence CCAGCTCTACCCAGCCGCGCCCA GCTCTTCTCGCCGCCCGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 286} {0: 1, 1: 0, 2: 1, 3: 3, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!