ID: 1061584043_1061584050

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1061584043 1061584050
Species Human (GRCh38) Human (GRCh38)
Location 9:131554968-131554990 9:131554986-131555008
Sequence CCGCGCCCACGCCGCCCGCGCTC CGCTCTTCTCGCCGCCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 86, 4: 616} {0: 1, 1: 0, 2: 2, 3: 12, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!