ID: 1061584058_1061584077

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1061584058 1061584077
Species Human (GRCh38) Human (GRCh38)
Location 9:131555013-131555035 9:131555062-131555084
Sequence CCTTCCCCTTCCCCGTGGTGAGT CCGTGCTGTCTGCGCGTGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 232} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!