ID: 1061762602_1061762609

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1061762602 1061762609
Species Human (GRCh38) Human (GRCh38)
Location 9:132860785-132860807 9:132860805-132860827
Sequence CCGGGTGGGCTCTTGCAGGTCAT CATGGGTTGGTCTCCTGGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 21, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!