ID: 1062049995_1062050003

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1062049995 1062050003
Species Human (GRCh38) Human (GRCh38)
Location 9:134442335-134442357 9:134442373-134442395
Sequence CCACGGACACCCGTCCTTGGGGT GAGTTCTCAGGCCAGAGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!