ID: 1062084565_1062084570

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1062084565 1062084570
Species Human (GRCh38) Human (GRCh38)
Location 9:134642032-134642054 9:134642062-134642084
Sequence CCGCCACAAAGAAGAACGGGGGG GTCCCCATGACCTCCTAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 95} {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!