ID: 1062166657_1062166668

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1062166657 1062166668
Species Human (GRCh38) Human (GRCh38)
Location 9:135111245-135111267 9:135111275-135111297
Sequence CCCACCCGTTGCTTTATCTTTTC GAAACCCTCATGGGTTGGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!