ID: 1062218663_1062218673

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1062218663 1062218673
Species Human (GRCh38) Human (GRCh38)
Location 9:135402854-135402876 9:135402882-135402904
Sequence CCTCCGTGCCTCCTCCAGCCTCC CCCTCAACACCGGCCACCGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 109, 4: 1016} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!