ID: 1062261508_1062261522

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1062261508 1062261522
Species Human (GRCh38) Human (GRCh38)
Location 9:135665371-135665393 9:135665405-135665427
Sequence CCCTCTGACCCCCTCGGGGACCC AAGTCCGGCCCAACCCTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 153} {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!