ID: 1062261509_1062261526

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1062261509 1062261526
Species Human (GRCh38) Human (GRCh38)
Location 9:135665372-135665394 9:135665412-135665434
Sequence CCTCTGACCCCCTCGGGGACCCC GCCCAACCCTGGGCGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 262} {0: 1, 1: 0, 2: 2, 3: 18, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!