ID: 1062261510_1062261521

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1062261510 1062261521
Species Human (GRCh38) Human (GRCh38)
Location 9:135665379-135665401 9:135665402-135665424
Sequence CCCCCTCGGGGACCCCACCTCCT CTGAAGTCCGGCCCAACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 349} {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!