ID: 1062261513_1062261532

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1062261513 1062261532
Species Human (GRCh38) Human (GRCh38)
Location 9:135665382-135665404 9:135665429-135665451
Sequence CCTCGGGGACCCCACCTCCTCTG GGAGGGTCTCGCAGTGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 335} {0: 1, 1: 0, 2: 3, 3: 39, 4: 505}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!