ID: 1062261516_1062261525

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1062261516 1062261525
Species Human (GRCh38) Human (GRCh38)
Location 9:135665392-135665414 9:135665411-135665433
Sequence CCCACCTCCTCTGAAGTCCGGCC GGCCCAACCCTGGGCGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149} {0: 1, 1: 0, 2: 3, 3: 12, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!