ID: 1062261517_1062261537

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1062261517 1062261537
Species Human (GRCh38) Human (GRCh38)
Location 9:135665393-135665415 9:135665444-135665466
Sequence CCACCTCCTCTGAAGTCCGGCCC GGCCCTGGGGTTTGGAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 242} {0: 1, 1: 1, 2: 11, 3: 71, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!