ID: 1062261519_1062261536

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1062261519 1062261536
Species Human (GRCh38) Human (GRCh38)
Location 9:135665399-135665421 9:135665441-135665463
Sequence CCTCTGAAGTCCGGCCCAACCCT AGTGGCCCTGGGGTTTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 150} {0: 1, 1: 0, 2: 3, 3: 31, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!