ID: 1062297620_1062297622

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1062297620 1062297622
Species Human (GRCh38) Human (GRCh38)
Location 9:135841208-135841230 9:135841225-135841247
Sequence CCTCACAGTGTAAACAAAGCCGC AGCCGCCAGGAAGTTTAAACTGG
Strand - +
Off-target summary {0: 65, 1: 567, 2: 484, 3: 266, 4: 165} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!