ID: 1062305903_1062305911

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1062305903 1062305911
Species Human (GRCh38) Human (GRCh38)
Location 9:135907121-135907143 9:135907157-135907179
Sequence CCAGCCCTCGGCGGCGGCGCGGC CATCTGCAGACAAAGGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 259} {0: 1, 1: 0, 2: 1, 3: 29, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!