ID: 1062305904_1062305914

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1062305904 1062305914
Species Human (GRCh38) Human (GRCh38)
Location 9:135907125-135907147 9:135907168-135907190
Sequence CCCTCGGCGGCGGCGCGGCCGCT AAAGGGCTGAGGCGGCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 162} {0: 1, 1: 0, 2: 1, 3: 19, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!