ID: 1062305905_1062305912

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1062305905 1062305912
Species Human (GRCh38) Human (GRCh38)
Location 9:135907126-135907148 9:135907160-135907182
Sequence CCTCGGCGGCGGCGCGGCCGCTC CTGCAGACAAAGGGCTGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 290} {0: 1, 1: 0, 2: 0, 3: 32, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!