ID: 1062305922_1062305945

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1062305922 1062305945
Species Human (GRCh38) Human (GRCh38)
Location 9:135907208-135907230 9:135907258-135907280
Sequence CCGCCCCTCGCCGCGCCGGGCCC CGCAGCCGGCCAGCCGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 108, 4: 818} {0: 1, 1: 0, 2: 0, 3: 15, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!