ID: 1062305927_1062305949

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1062305927 1062305949
Species Human (GRCh38) Human (GRCh38)
Location 9:135907218-135907240 9:135907271-135907293
Sequence CCGCGCCGGGCCCGGTGCGCCCC CCGGGAGGGGCGCCCGAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 421} {0: 1, 1: 0, 2: 2, 3: 24, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!