ID: 1062319535_1062319551

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1062319535 1062319551
Species Human (GRCh38) Human (GRCh38)
Location 9:135984079-135984101 9:135984117-135984139
Sequence CCCCCTGCACCCCTGCTCAGCTA TCCTCAGAGGAGGACAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 356} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!