ID: 1062319540_1062319553

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1062319540 1062319553
Species Human (GRCh38) Human (GRCh38)
Location 9:135984089-135984111 9:135984118-135984140
Sequence CCCTGCTCAGCTACAACCAGCCC CCTCAGAGGAGGACAGGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 73, 4: 589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!