| ID: 1062379582_1062379601 | View in Genome Browser | 
| Spacer: 29 | 
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1062379582 | 1062379601 | 
| Species | Human (GRCh38) | Human (GRCh38) | 
| Location | 9:136280795-136280817 | 9:136280847-136280869 | 
| Sequence | CCCCGCTGCCAGCCAAGGAGGGT | GGTGGTCCAGGGTTAGGGGTTGG | 
| Strand | - | + | 
| Off-target summary | No data | No data | 
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||