ID: 1062574462_1062574482

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1062574462 1062574482
Species Human (GRCh38) Human (GRCh38)
Location 9:137199958-137199980 9:137200002-137200024
Sequence CCTTTGGCTTCCACTGTCCCGAC CGGTTGGCAGGGCCGGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126} {0: 1, 1: 0, 2: 0, 3: 22, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!