ID: 1062574477_1062574483

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1062574477 1062574483
Species Human (GRCh38) Human (GRCh38)
Location 9:137199993-137200015 9:137200008-137200030
Sequence CCCGCGAGGCGGTTGGCAGGGCC GCAGGGCCGGCCCGGGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111} {0: 1, 1: 0, 2: 8, 3: 80, 4: 647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!