ID: 1062587098_1062587107

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1062587098 1062587107
Species Human (GRCh38) Human (GRCh38)
Location 9:137254341-137254363 9:137254375-137254397
Sequence CCAGCGGCAAGAGAGCTGTGGTA GGGAGCTCGGCCCGGCTTGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!