ID: 1063106807_1063106818

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1063106807 1063106818
Species Human (GRCh38) Human (GRCh38)
Location 10:2999205-2999227 10:2999254-2999276
Sequence CCTACCTCAGCCCTTCCTCAAGT TGGACTTACGATCAGCATACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 452} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!