ID: 1063115320_1063115340

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1063115320 1063115340
Species Human (GRCh38) Human (GRCh38)
Location 10:3068171-3068193 10:3068210-3068232
Sequence CCCCCCCGCCCCCCAACTCCGCC AATGTCGAGGAAGAAACGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!