ID: 1063236238_1063236246

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1063236238 1063236246
Species Human (GRCh38) Human (GRCh38)
Location 10:4119309-4119331 10:4119333-4119355
Sequence CCTCCTAAGGCCACCCCTGTAAC AGTGCGAGGCTGCCGAGACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!