ID: 1063267963_1063267972

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1063267963 1063267972
Species Human (GRCh38) Human (GRCh38)
Location 10:4475195-4475217 10:4475228-4475250
Sequence CCCATTCTCCTGAATGCCCTGGA CACAGCTGCCCTGGCTCTTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!