ID: 1063886825_1063886834

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1063886825 1063886834
Species Human (GRCh38) Human (GRCh38)
Location 10:10588338-10588360 10:10588378-10588400
Sequence CCTAGCTCCAACCTTGTCCCACA AAGCTGTCACTTACTCCTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 17, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!