ID: 1064269492_1064269500

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1064269492 1064269500
Species Human (GRCh38) Human (GRCh38)
Location 10:13852111-13852133 10:13852152-13852174
Sequence CCACACCCCATCTGTGGAAAAAT TCCCTGGTGCCAAAAGGTTTGGG
Strand - +
Off-target summary No data {0: 3, 1: 140, 2: 1349, 3: 1800, 4: 1420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!