ID: 1065239898_1065239912

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1065239898 1065239912
Species Human (GRCh38) Human (GRCh38)
Location 10:23694845-23694867 10:23694891-23694913
Sequence CCCGCCCGCGGGGGAGCCTCGAG GTTTCCGGGGGAGGACGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 91} {0: 1, 1: 0, 2: 2, 3: 12, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!