ID: 1065782577_1065782582

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1065782577 1065782582
Species Human (GRCh38) Human (GRCh38)
Location 10:29183723-29183745 10:29183740-29183762
Sequence CCCTTTGCCATTGGGCTGCTCTC GCTCTCATCACAGGGAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 175} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!